View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18387_high_5 (Length: 540)
Name: NF18387_high_5
Description: NF18387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18387_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 7 - 475
Target Start/End: Complemental strand, 47015191 - 47014723
Alignment:
| Q |
7 |
atgtcgaagaaaataaaacattgcttctgaaatatgagacacatattgcgcctcccatcacaagccagttgaattctgatagcagaacaaactcatcgcc |
106 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
47015191 |
atgtccaaaaaaataaaacattgcttctgaaatatgagacacatattgcgcctcccatcacaagccagttgaattctgatagcggaacaaactcaccgcc |
47015092 |
T |
|
| Q |
107 |
atcaagatcttcttcctgtatttgatagttcaatcatccaactgacctcatcacatgtgttggtgattcaatctcatataatgttgaccatactgttatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47015091 |
atcaagatcttcttcctgtatttgatagttcaatcatccaactgacctcatcacatgtgttggtgattcaatctcatataatgttgaccatactgttatt |
47014992 |
T |
|
| Q |
207 |
agccccttttcatagtgcccaaatatttaatcaaacaaagaggacaaggctttcaacaaatctgcgaccaaccacatcgtgtcgtatctcctttgtttct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47014991 |
agccccttttcatagtgcccaaatatttaatcaaacaaagaggacaaggctttcaacaaatctgcgaccaaccacatcgtgtcgtatctcctttgtttct |
47014892 |
T |
|
| Q |
307 |
atttgtccagccaaactgttagcctttaacttcaatactgagagagatatgcctcccaccacaattgtaagccaccgaatctgagattgcctagtggttt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47014891 |
atttgtccagccaaactgttagcctttaacttcaatactgatagagatatgcctcccaccacaattgtaagccaccgcatctgagattgcctagtggttt |
47014792 |
T |
|
| Q |
407 |
aggccagtgttgcgttccctgatgatggcaccacggttttccatcgacggtggaaaatatctcttcccc |
475 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47014791 |
aggtcagtgttgtgttccctgatgatggcaccacggttttccatcgacggtggaaaatatctcttcccc |
47014723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University