View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18388_high_14 (Length: 299)
Name: NF18388_high_14
Description: NF18388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18388_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 12311217 - 12311436
Alignment:
| Q |
9 |
tctgcaatgttgtgtatattttctaagctgtgagaggatcctgtttacatgatgctttgtatttatttattgatgtgtgaatttgttatattatgtgatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
12311217 |
tctgcaatgttgtgtatattttctaagctgtgagaggatcctgtttacatgatgctttgtatttatttattgatgtgtgaatttgttatattatatgaag |
12311316 |
T |
 |
| Q |
109 |
tgattgtctttcctattcacccttcttttt----tccttggaagtacattgctctttagt-----tgttgatccttctttgttttcatgcttatttaaat |
199 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| | ||||||||||||||| ||| | ||||||||||||||||||||||||||||||| || |
|
|
| T |
12311317 |
tgattgtctttccttttcacccttttttttcttcttcttggaagtacattgtgttttttttcctctgttgatccttctttgttttcatgcttattttaa- |
12311415 |
T |
 |
| Q |
200 |
tttccagaaagtatctaaaaa |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12311416 |
tttccagaaagtatctaaaaa |
12311436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University