View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18388_high_20 (Length: 246)
Name: NF18388_high_20
Description: NF18388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18388_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 12311075 - 12310837
Alignment:
| Q |
1 |
tcctcgtccatttcatcatcgatgtccaagctaccagtaagatactgagtgagagactgatgagttccggctgcaggaatagtagcctcgctaattatct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12311075 |
tcctcgtccatttcgtcatcgatgtccaagctaccagtaagatactgagtgagagactgatgagttccggctgctggaatagtagcctcgctaattatct |
12310976 |
T |
|
| Q |
101 |
gcattatttcttcaagtgtttgcattggttgttcaggctcctgaaactgctcgctcgttgtattcccaacgataagatcagcgggaaggttcttcaaaaa |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
12310975 |
gcattatttcttcaattgtttgcattggttgttcaggctcctgaaactgctcgcttgttgtattccccacgataagatcagctggaaggttcttcaaaaa |
12310876 |
T |
|
| Q |
201 |
ccaatcgtggtttcgaatctctggcatggttattctctg |
239 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
12310875 |
ccaatcatggtttcgaatctccggcatgcttattctctg |
12310837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 239
Target Start/End: Complemental strand, 34079522 - 34079455
Alignment:
| Q |
172 |
ataagatcagcgggaaggttcttcaaaaaccaatcgtggtttcgaatctctggcatggttattctctg |
239 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || ||||||| ||||||||| ||| |||||||||| |
|
|
| T |
34079522 |
ataagatcagttggaaggttcttcaaaaaccactcatggtttctaatctctggaatgcttattctctg |
34079455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University