View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18388_low_11 (Length: 377)
Name: NF18388_low_11
Description: NF18388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18388_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 280 - 353
Target Start/End: Original strand, 4098292 - 4098365
Alignment:
| Q |
280 |
aaattaccttcctttaaaacatgtgctcaataagatttcttcattctgcaaaatccgccaaccttgcttagcta |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098292 |
aaattaccttcctttaaaacatgtgctcaataagatttcttcattctgcaaaatccgccaaccttgcttagcta |
4098365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 198 - 282
Target Start/End: Original strand, 4098152 - 4098246
Alignment:
| Q |
198 |
tcgttccaaattctaatattttggccat---------acattccggaatgatcgataactttatgtcttgc-tgtaggatgcttctccaagtaaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4098152 |
tcgttccaaattctaatattttggccatcgaactaccacattccggaatgatcaataactttatgtcttgcttgtaggatgcttctccaagtaaa |
4098246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University