View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18388_low_13 (Length: 335)

Name: NF18388_low_13
Description: NF18388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18388_low_13
NF18388_low_13
[»] chr2 (1 HSPs)
chr2 (19-292)||(4097880-4098152)


Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 292
Target Start/End: Original strand, 4097880 - 4098152
Alignment:
19 tggaaaacgactgatacgttacttcactgttattgttggtggtttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4097880 tggaaaacgactgatacgttacttcactgttattgttggtggtttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgc 4097979  T
119 tatgaacatgtttcttttaacannnnnnnagccttcaatattttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaata 218  Q
    ||||||||||||| ||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4097980 tatgaacatgttt-ttttaacatttttttagccttcaatattttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaata 4098078  T
219 gtgagatcaacataaattgcattcaataaaatgttaaaagttaaaaacagagtgttttgattactactattact 292  Q
    ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||    
4098079 gtgagatcaacataaattgcattcaataaaatgataaatgttaaaaacagagtgttttggttactactattact 4098152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University