View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18388_low_19 (Length: 260)
Name: NF18388_low_19
Description: NF18388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18388_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 50 - 243
Target Start/End: Complemental strand, 8310077 - 8309884
Alignment:
| Q |
50 |
gagaaacaatttatggtgaaatggttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgctatgatcattaaga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8310077 |
gagaaacaatttatggtgaaatggttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgctatgatcattaaga |
8309978 |
T |
 |
| Q |
150 |
tttatacggcattgggatttatcagaaacattaggccggttgttaagttgcttgatgatattcagatttcaaatgagaacgtggaggcaatgag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8309977 |
tttatacggcattgggatttatcagaaacattaggccggttgttaagttgcttgatgatattgagatttcaaatgagaacgtggaggcaatgag |
8309884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 137
Target Start/End: Complemental strand, 27663044 - 27662957
Alignment:
| Q |
50 |
gagaaacaatttatggtgaaatggttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgcta |
137 |
Q |
| |
|
||||||||||||||| |||| | |||| |||||||| ||||| |||||||||||||| | | | |||||||||||||||||| |||| |
|
|
| T |
27663044 |
gagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagcta |
27662957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 252
Target Start/End: Complemental strand, 27662942 - 27662890
Alignment:
| Q |
200 |
cttgatgatattcagatttcaaatgagaacgtggaggcaatgagtgatgatgt |
252 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| | |||||| |
|
|
| T |
27662942 |
cttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgt |
27662890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University