View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18389_low_10 (Length: 243)
Name: NF18389_low_10
Description: NF18389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18389_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 228
Target Start/End: Original strand, 51247542 - 51247766
Alignment:
| Q |
4 |
gagcaagcaaagcatatgcagtttcatttttcaaattatgaactttcattcaatcaataaattcaagttatagctcgatgaatttatggataaattgatg |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51247542 |
gagcaagcaaagcatatgtagtttcatttttcaaattatgcactttcattcaatcaataaattcaagttatagctcgatgaatttatggataaattgatg |
51247641 |
T |
 |
| Q |
104 |
aaaaaactagtttcaatcatctatctaatagtagtactatcgttcactccaagcgactgattgatcactttatcaatattctgtcgttgtctttttgctt |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51247642 |
aaaaaactagtttcaatcatgaatctaatagtagtactatcgttcactccaagcgactgattgatcactttatcaatattctgtcgttgtctttttgctt |
51247741 |
T |
 |
| Q |
204 |
ctagggaaatctctttaatacataa |
228 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
51247742 |
ctagggaaatctctttaatacataa |
51247766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University