View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18390_low_1 (Length: 303)
Name: NF18390_low_1
Description: NF18390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18390_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 29607222 - 29606923
Alignment:
| Q |
1 |
tcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607222 |
tcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatg |
29607123 |
T |
|
| Q |
101 |
tttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607122 |
tttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgat |
29607023 |
T |
|
| Q |
189 |
ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607022 |
ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtg |
29606923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University