View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_high_11 (Length: 405)
Name: NF18391_high_11
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 164 - 387
Target Start/End: Complemental strand, 34786106 - 34785883
Alignment:
| Q |
164 |
cattttgttctcagagaaatgacctctggtaatccagaattcggccagaaggtaagtaaagtctgaccaaagtgattgttttagctagaggtcgaacgcg |
263 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
34786106 |
cattttgttctcagagaaatgaactctggtaatccagaattcggccagaaggtaagtaaagtctgaccaaagtgattgttttagctagaggtcaaactcg |
34786007 |
T |
|
| Q |
264 |
actacactcttgatcagttccaccttagcggaatctcattaactgcttaagttcaaccacttaagtagctagtaagtatgaagaaataatatatttgttt |
363 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34786006 |
actacactcttgatcagttcgaccttagcggaatctcattaactacttaagttcaaccacttaagtagctagtaagtatgaagaaataatatatttgttt |
34785907 |
T |
|
| Q |
364 |
gtatgtatgtatgtatgaaacgac |
387 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34785906 |
gtatgtatgtatgtatgaaacgac |
34785883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 34786226 - 34786105
Alignment:
| Q |
16 |
atgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgtcttcctgtttaatcccaacagataagaagcaaatcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34786226 |
atgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgtcttcctgtttaatcccaacagataagaagcaaatcc |
34786127 |
T |
|
| Q |
116 |
tcctgcaacaaacacaagcaca |
137 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34786126 |
tcctgcaacaaacacaagcaca |
34786105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University