View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_high_14 (Length: 332)
Name: NF18391_high_14
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 323
Target Start/End: Complemental strand, 32781242 - 32780925
Alignment:
| Q |
15 |
aacaaatattagagaaatagtggcttcagtaacaagtgtccaagaaagttgcagc---tgctttgattgttgttg------ttttggtatgtccttcatg |
105 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
32781242 |
aacaaatattagagaaatagtgacatcagtaacatgtttccaagaaagttgctgcaactgctatgattgttgttgctgttgttttggtatgtccttcatg |
32781143 |
T |
|
| Q |
106 |
gaagaagtcttcaaatatatctggnnnnnnnattcttttgcaaataaaaaacagatcaagctcattgcctggatatatttgatcaaaatatttatctttg |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
32781142 |
gaagaagtcttcaaatatatctggtttttttattcttttgcaaatcaaaaacagatcaagctcattgcctggatatatttgatcaaagtgtttgtctttg |
32781043 |
T |
|
| Q |
206 |
aactagcaatgtttcaccctctagcattctcattgtttattggtgtaccaagataatctaaagtttgcagcattgtttatatagcatgcctatttaatgt |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32781042 |
aactagcaatgtttcaccctctagcagtctcattgtttattggtgtaccaagataatctaaagtttgcaacattgtttatatagcatgcctatttaatgt |
32780943 |
T |
|
| Q |
306 |
cgatttgtattggttcat |
323 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32780942 |
cgatttgtattggttcat |
32780925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University