View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_high_15 (Length: 327)
Name: NF18391_high_15
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 23323950 - 23324244
Alignment:
| Q |
19 |
ccatgatcagaaactggcttttcactgggcaccctcaaataattgaagtgttgattttgatgatggttgagataggccatgttggtgtttgaaaactcag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23323950 |
ccatgatcagaaactggcttttcactgggcaccctcaaataattgaagtgttgattttgatgatgattgagataggccatgttggtgtttgaaaactcag |
23324049 |
T |
 |
| Q |
119 |
gtgaagaaacagtttcaaagaatgaatcgaccggtggagaaccgtgtgagagactgctagattctgtaatgctagggtttgaagagtgaaacattagagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324050 |
gtgaagaaacagtttcaaagaatgaatcgaccggtggagaaccgtgtgagagactgctagattctgtaatgctagggtttgaagagtgaaacattagagg |
23324149 |
T |
 |
| Q |
219 |
attttcttgttggaatccagaaatgaacttgtcttggaaatggattggacttaggttgttcattagtttttgcagctgatttttagcttcatctc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324150 |
attttcttgttggaatccagaaatgaacttgtcttggaaatggattggacttgggttgttcattagtttttgcagctgatttttagcttcatctc |
23324244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University