View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_high_17 (Length: 295)
Name: NF18391_high_17
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 50 - 281
Target Start/End: Original strand, 44623641 - 44623870
Alignment:
| Q |
50 |
ttgattctaaaatacaatggtttggaattnnnnnnnnnntggttatgataaaaattgaaattgaggatttcaaactttatattttatcttgacacatatt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623641 |
ttgattctaaaatacaatggtttggaattaaaaaaaa--tggttatgataaaaattgaaatcgaggatttcaaactttatattttatcttgacacatatt |
44623738 |
T |
 |
| Q |
150 |
tcttctaagatagtaattaaagttgaactcaagtttagaaaacaatgttaaaattcatagaaaaagttttacgctcatttgaaaatcacaaaatttggag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623739 |
tcttctaagatagtaattaaagttgaactcaagtttagaaaacaatgttaaaattcatagaaaaagttttacgctcatttgaaaatcacaaaatttggag |
44623838 |
T |
 |
| Q |
250 |
atgttaatcttcaaagttgcgaggaatatatt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44623839 |
atgttaatcttcaaagttgcgaggaatatatt |
44623870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University