View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_high_25 (Length: 267)
Name: NF18391_high_25
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_high_25 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 62 - 267
Target Start/End: Complemental strand, 32896982 - 32896777
Alignment:
| Q |
62 |
ttccaaattttatattgtgatagcagatatgctatttaactatatcataaccctccattctaagaaagaagcaaacacagagctggattggcatgtaatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32896982 |
ttccaaattttatattgtgatagcagatatgctatttaactatatcataaccctccattctaagaaagaagcaaacacagagctggattggcatgtaatg |
32896883 |
T |
|
| Q |
162 |
agagaaaagttgcaatttaagttcattgttttacttcttgtgcccagcaattcccaactagctaatgcattccctaagccactacattttcatgttttta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32896882 |
agagaaaagttgcaatttaagttcattgttttacttcttgtgcccagcaattcccaactagctaatgcattccctaagccactacattttcatgttttta |
32896783 |
T |
|
| Q |
262 |
tggtct |
267 |
Q |
| |
|
|||||| |
|
|
| T |
32896782 |
tggtct |
32896777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 32897416 - 32897369
Alignment:
| Q |
18 |
taatccaactattgaattgtccaacattgaaggtgatgtaagggttcc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32897416 |
taatccaactattgaattgtccaacattgaaggtgatgtaagggttcc |
32897369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University