View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_low_17 (Length: 312)
Name: NF18391_low_17
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 50492075 - 50492369
Alignment:
| Q |
1 |
aagagaaatagaggaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcgtcgcgaatgatatcgggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50492075 |
aagagaaatagaggaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcatcgcgaatgatatcgggat |
50492174 |
T |
 |
| Q |
101 |
caacggaagcttcgtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaggttggtgaatcgggagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50492175 |
caacggaagcttcgtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaagttggtgaatcgggagt |
50492274 |
T |
 |
| Q |
201 |
tgatgcaggattttctggatccatgattcttcgcttcttctcctctagctctgaagtgtttcaatttcagttttgctctgaagaattcgattgtg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
50492275 |
tgatgcaggattttctggatccatgattcttcacttcttctcttctagctctgaagtgtttcaatttcagtttcgctctgaataattcgattgtg |
50492369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University