View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_low_19 (Length: 295)
Name: NF18391_low_19
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 15 - 280
Target Start/End: Complemental strand, 50492036 - 50491771
Alignment:
| Q |
15 |
ttattgaattgatgatttttgaacagtgattatcagaggatgggtgaagccgatcagttcgaatcggttgggttggatgattcggttgaggatgagagag |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492036 |
ttattgaattgatgattgttgaacagtgattatcagaggatgggtgaagccgatcagttcgaatcggttgggttggatgattcggttgaggatgagagag |
50491937 |
T |
 |
| Q |
115 |
attttgatcagatcatggaggatcgtagagctgctgagattgaacttgatactcgcgatggccgcgcttccaatcgctctaaacttcctcagcttctcca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50491936 |
attttgatcagatcatggaggatcgtagagctgctgagattgaacttgatactcgcgatggccgcgcttccaatcgctctaaacttcctcagcttctcca |
50491837 |
T |
 |
| Q |
215 |
tgacggaggtaaaccatttctctttcatttcgtttagttttgatcaattattcatgcttagttact |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50491836 |
tgacggaggtaaaccatttctctttcatttcgtttagttttgattaattattcatgcttagttact |
50491771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University