View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18391_low_23 (Length: 282)
Name: NF18391_low_23
Description: NF18391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18391_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 21 - 266
Target Start/End: Complemental strand, 53639262 - 53639017
Alignment:
| Q |
21 |
tagttacttacttacttatactaatacaactgtccatgcaatattaacctacggttgaaattcaacatgtgnnnnnnn---ggggaaaattcattcaata |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53639262 |
tagttagttacttacttatactaatacaactgtccatgcaatattaacctacggttgaaattcaacatgtgttttttttttggggaaaattcattcaata |
53639163 |
T |
|
| Q |
118 |
tgtgttgtttaagttacatatcttcttcatacatgattattgtaagtagnnnnnnnnnatgaaggaatgattataatattatccatgtgattcgcgcgca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53639162 |
tgtgttgtttaagttacatatcttcttcatacatgattattataagtagtttttttttataaaggaatgat---aatattatccatgtgattcgcgcgca |
53639066 |
T |
|
| Q |
218 |
acatactattttaatttgctcacatgctgtacttttcgaagtcctttct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639065 |
acatactattttaatttgctcacatgctgtacttttcgaagtcctttct |
53639017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University