View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18393_high_10 (Length: 224)
Name: NF18393_high_10
Description: NF18393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18393_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 42 - 207
Target Start/End: Original strand, 45946417 - 45946582
Alignment:
| Q |
42 |
cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946417 |
cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag |
45946516 |
T |
 |
| Q |
142 |
agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946517 |
agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta |
45946582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 45939446 - 45939495
Alignment:
| Q |
159 |
gtttagaccagaaactatggaaagttttgcagacataattagatcattag |
208 |
Q |
| |
|
||||| ||||||| | ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45939446 |
gtttacaccagaagccatggaaatttttgcagacacaattagatcattag |
45939495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University