View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18393_low_11 (Length: 224)

Name: NF18393_low_11

Description: NF18393

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF18393_low_11

[»] chr1 (2 HSPs)

Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 2)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 166; E-Value: 5e-89

Query Start/End: Original strand, 42 - 207

Target Start/End: Original strand, 45946417 - 45946582

Alignment:

Q	42	cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag	141	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	45946417	cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag	45946516	T

Q	142	agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta	207	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	45946517	agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta	45946582	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2

Raw Score: 30; E-Value: 0.00000008

Query Start/End: Original strand, 159 - 208

Target Start/End: Original strand, 45939446 - 45939495

Alignment:

Q	159	gtttagaccagaaactatggaaagttttgcagacataattagatcattag	208	Q
		\|\|\|\|\| \|\|\|\|\|\|\| \| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	45939446	gtttacaccagaagccatggaaatttttgcagacacaattagatcattag	45939495	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]