View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18393_low_11 (Length: 224)

Name: NF18393_low_11
Description: NF18393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18393_low_11
NF18393_low_11
[»] chr1 (2 HSPs)
chr1 (42-207)||(45946417-45946582)
chr1 (159-208)||(45939446-45939495)


Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 42 - 207
Target Start/End: Original strand, 45946417 - 45946582
Alignment:
42 cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45946417 cccctactcttaatatcatgaagttagaatcttacttttatatacttttatatcatgacatgaaacttaatcttgaattttattttcttcttgttttaag 45946516  T
142 agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45946517 agtggtatatcctccaagtttagaccagaaactatggaaagttttgcagacataattagatcatta 45946582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 45939446 - 45939495
Alignment:
159 gtttagaccagaaactatggaaagttttgcagacataattagatcattag 208  Q
    ||||| ||||||| | ||||||| ||||||||||| ||||||||||||||    
45939446 gtttacaccagaagccatggaaatttttgcagacacaattagatcattag 45939495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University