View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18393_low_7 (Length: 266)
Name: NF18393_low_7
Description: NF18393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18393_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 32606238 - 32606495
Alignment:
| Q |
1 |
ttctcattgtttaatgagaatcttaaacctactatttcggagcagaattatgggttgtttaaaccggatcttaccccggtttatgacgttggagttttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606238 |
ttctcattgtttaatgagaatcttaaacctactatttcggagcagaattatgggttgtttaaaccggatcttaccccggtttatgacgttggagttttaa |
32606337 |
T |
 |
| Q |
101 |
cccaaaaacatcagcaggtacctatacattttctttttgctttcatttatccgtttattttagtggnnnnnnnntagagaat----cttactgttttaga |
196 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32606338 |
cccaaaaacatcagcaggtacaaatac-ttttttttttcctttcatttatccgtttattttagtgg-aaaaaaatagagaatcttacttactgttttaga |
32606435 |
T |
 |
| Q |
197 |
cctttacgtgacaaagtagaacacgacatgtttttatgcaagtacatttatgcccctatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606436 |
cctttacgtgacaaagtagaacacgacatgtttttatgcaagtacatttatgcccctatg |
32606495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University