View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18394_low_16 (Length: 243)
Name: NF18394_low_16
Description: NF18394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18394_low_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 3 - 243
Target Start/End: Complemental strand, 21078597 - 21078357
Alignment:
| Q |
3 |
catcatcaccaccaccaccacgagacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttcttctcacgatgctgcgcttttt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21078597 |
catcatcaccaccaccaccacgagacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttcttctcacgatgctgcgtttttt |
21078498 |
T |
|
| Q |
103 |
ctttttatgggaacttggaggaaaatatttggataagttaataactggtggtgcatcatccacttgaaactgatcaagatcacacatatcactctgttgc |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078497 |
ctttttatgggaacttggaggcaaatatttggataagttaataactggtggtgcatcatccacttgaaactgatcaagatcacacatatcactctgttgc |
21078398 |
T |
|
| Q |
203 |
tccaagaaggagacagggaagaaggatgtggttggagactc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21078397 |
tccaagaaggagacagggaagaaggatgtggtcggagactc |
21078357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 3073724 - 3073780
Alignment:
| Q |
25 |
agacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttct |
81 |
Q |
| |
|
||||||||| |||||| ||| |||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
3073724 |
agacatatcgaagagtgtatatgctccattaagatgttcatgatcaatgatatttct |
3073780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 27732088 - 27732144
Alignment:
| Q |
25 |
agacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttct |
81 |
Q |
| |
|
|||||||| |||||| | |||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
27732088 |
agacatattgaagagtgtttgtgctccattaagatgttcatgatcaatgatatttct |
27732144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University