View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18394_low_19 (Length: 213)
Name: NF18394_low_19
Description: NF18394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18394_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 34316635 - 34316815
Alignment:
| Q |
17 |
agaaagctagagtagtttggtctgtggatcttcatcagaaatttgttaaagcggtgaatcagcttggattcgatagtaagtttcttatcaacattctcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34316635 |
agaaagctagagtagtttggtctgtggatcttcatcagaaatttgttaaagcggtgaatcagcttggattcgatagtaagtttcttatcaacattctcta |
34316734 |
T |
 |
| Q |
117 |
cgaagtcagattcaaataaatctgcttattgctatgcacgccaatgaacggaacttaaattccggtcttgtttatcatatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34316735 |
cgaagtcagattcaaataaatctgcttattgctatgcacgccaatgaacggaacttaaattccggtcttgtttatcatatt |
34316815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 34322009 - 34322050
Alignment:
| Q |
81 |
tggattcgatagtaagtttcttatcaacattctctacgaagt |
122 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34322009 |
tggatttggtagtaagtttcttatcaacattctctatgaagt |
34322050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 38952894 - 38952809
Alignment:
| Q |
17 |
agaaagctagagtagtttggtctgtggatcttcatcagaaatttgttaaagcggtgaatcagcttggattcgatagtaagtttctt |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
38952894 |
agaaagctagagtagtttggtctgtagatcttcatcagaagtttgttaaagcagtgaatcagattggatttgatagtaagtttctt |
38952809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University