View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18395_low_10 (Length: 254)
Name: NF18395_low_10
Description: NF18395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18395_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 26610164 - 26610075
Alignment:
| Q |
161 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggttttg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttg |
26610075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 5957709 - 5957751
Alignment:
| Q |
1 |
agtttccaatggacccagatatatacaccgaatggaagatgtt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5957709 |
agtttccaatggacccagatatatacacagaatggaagatgtt |
5957751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University