View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18395_low_7 (Length: 370)
Name: NF18395_low_7
Description: NF18395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18395_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 43 - 366
Target Start/End: Complemental strand, 33412500 - 33412182
Alignment:
| Q |
43 |
tatagacaac-aataattaatttatggcgacaaaacaaaaaattatagaacattttgaagcagacnnnnnnnactctgtgacggcttaataccctatagt |
141 |
Q |
| |
|
|||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
33412500 |
tatagacaaccaataatttatttatggtgacaaaacaaaaaattatagaacattttgaagcagactttttttacactgtgagggcttaataccctatagt |
33412401 |
T |
 |
| Q |
142 |
gttgtgcatgcattttgccgctggcgtcgcacggccacgacatacttttgttgtgtcgtttgacattcattgtttgtttgttactgtataattttcagta |
241 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
33412400 |
gttgtgcatgcattt-gccgctggcgtcgcacggccacgacatgcttttgttgtgtcgtttgacattcattgtttgtttgt-----cataattttcagca |
33412307 |
T |
 |
| Q |
242 |
aagttatccctttttcttttatggatcgttgctttaagtttcccattttcctctcaccccctctctttcttggtggacatatcttattttcttcaatgtt |
341 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33412306 |
aagttgtccctttttcttttatggatcgttgctttaagtttcccattttcctctcaccccctctctttcttggtggatatatcttattttcttcaatgtt |
33412207 |
T |
 |
| Q |
342 |
ctaatcattttcccctatgcttctc |
366 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
33412206 |
ctaatcattttcccctatgtttctc |
33412182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University