View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18396_high_20 (Length: 248)
Name: NF18396_high_20
Description: NF18396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18396_high_20 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 131 - 230
Target Start/End: Original strand, 14043309 - 14043408
Alignment:
| Q |
131 |
tttctcccccgtgccatccatgtgaccctgtacgaaatgtgcacccgtttgactaaccggtgttacttccctttcaagaaccgtctttgcctcgaccttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14043309 |
tttctcccccgtgccatccatgtgaccctgtacgaaatgtccacccgtttgactaaccggtgttacttccctttcaagaaccgtctttgccttgaccttt |
14043408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 13929119 - 13929216
Alignment:
| Q |
131 |
tttctcccccgtgccatccatgtgaccctgtacgaaatgtgcacccgtttgactaaccggtgttacttccctttcaagaaccgtctttgcctcgacct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13929119 |
tttctcccccgtgccatccatgtgaccctgtacgaaatgtccacccgtttgactaatctgtgttacttccctttcaagaaccgtctttgcctcgacct |
13929216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 134
Target Start/End: Original strand, 14043200 - 14043287
Alignment:
| Q |
47 |
tatacaaacctagaacttcttgatattattgcagggtggatttgtcaggaaaataattgttcaagaatttgtcaaggtatttgctttc |
134 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14043200 |
tatacaaacctataacttcttgatattattgcagggtggatttgtgaggaaaataattgttcaagaatttgtcaaggtatttgctttc |
14043287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 56 - 134
Target Start/End: Original strand, 13929019 - 13929097
Alignment:
| Q |
56 |
ctagaacttcttgatattattgcagggtggatttgtcaggaaaataattgttcaagaatttgtcaaggtatttgctttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13929019 |
ctagaacttcttgatattattgcagggtggatttgtgaggaaaataattgttcaagaatttgtcaaggtatttgctttc |
13929097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 14042795 - 14042846
Alignment:
| Q |
1 |
cggtggatgaaaataagaacacgaaatgatgtgtaaaattgggatgtataca |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14042795 |
cggtggatgaaaataagaacacgaaatgatgtgtaaaattggcatgtataca |
14042846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 75 - 128
Target Start/End: Complemental strand, 13899018 - 13898965
Alignment:
| Q |
75 |
ttgcagggtggatttgtcaggaaaataattgttcaagaatttgtcaaggtattt |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13899018 |
ttgcagggtggatttgtgaggaaaataattgttcaagaatttgccaaggtattt |
13898965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 51
Target Start/End: Original strand, 14081661 - 14081710
Alignment:
| Q |
2 |
ggtggatgaaaataagaacacgaaatgatgtgtaaaattgggatgtatac |
51 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
14081661 |
ggtggatgaaaataagaacatgagatgatgtgtaaaattggcatgtatac |
14081710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 209
Target Start/End: Complemental strand, 13887763 - 13887685
Alignment:
| Q |
131 |
tttctcccccgtgccatccatgtgaccctgtacgaaatgtgcacccgtttgactaaccggtgttacttccctttcaaga |
209 |
Q |
| |
|
||||||||| || ||||||| |||||||||||||||||| ||||| || ||| | ||||||| ||| |||||||||| |
|
|
| T |
13887763 |
tttctccccggttccatccaggtgaccctgtacgaaatgcccacccattctactcatcggtgtttcttacctttcaaga |
13887685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 117
Target Start/End: Complemental strand, 14013019 - 14012977
Alignment:
| Q |
75 |
ttgcagggtggatttgtcaggaaaataattgttcaagaatttg |
117 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
14013019 |
ttgcaggatggatttgtcaggaaattaattgttcaataatttg |
14012977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 89614 - 89550
Alignment:
| Q |
133 |
tctcccccgtgccatccatgtgaccctgtacgaaatgtgcacccgtttgactaaccggtgttact |
197 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| || || |||||||||||||| |
|
|
| T |
89614 |
tctcccccgtgccatccacgtgaccctgtacgaaatgcccacccattcgagtaaccggtgttact |
89550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University