View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18396_high_25 (Length: 214)
Name: NF18396_high_25
Description: NF18396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18396_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 504156 - 504014
Alignment:
| Q |
55 |
caacaaaaatgaaggactgaacattttattggaaggaaagagatacatcgagcaacataatccagttatttaaatcctttaattcatttcttaattacat |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504156 |
caacataaatgaaggactgaacattttattggaaggaaagagatacatcgagcaacataatc-agttatttaaatcctttaattcatttcttaattacat |
504058 |
T |
 |
| Q |
155 |
atcgttttaaaacaactatgtgccatttataaagtaacattcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504057 |
atcgttttaaaacaactatgtgccatttataaagtaacattcat |
504014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University