View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18396_low_19 (Length: 274)
Name: NF18396_low_19
Description: NF18396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18396_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 16761278 - 16761033
Alignment:
| Q |
18 |
tattctgacagtaaaatcaattcaacacaagattgttaaaatcaaaaattaacttttactgctcacaaaataaatatccaaccgtgcacttaccgtcagg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16761278 |
tattctgatagtaaaatcaattcaacacaagat-gttaaaatcaaaaattaacttttactgctcacaaaataaatatccaaccgtgcacttaccgtcagg |
16761180 |
T |
|
| Q |
118 |
gtgtcttgatgtggaaactctgtttcaatctgtggattcgtataaatcacaccattgtttttactcttttatttggaagaaactttatttatcattattc |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16761179 |
gtgtctggatgtggaaactctgtttcaatctatggattcgtatagatcacaccattgtttttactcttttatttggaagaaactttatttatcattattc |
16761080 |
T |
|
| Q |
218 |
atttgtccttcttcctctatagatagtaacagctctttatgcttcat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16761079 |
atttgtccttcttcctctatagatagtaacagctctttatgcttcat |
16761033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University