View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18396_low_25 (Length: 232)
Name: NF18396_low_25
Description: NF18396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18396_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 35955131 - 35955331
Alignment:
| Q |
16 |
ggaagaacttccaaccttttgagtctgccgcttccgaagcaccggtagnnnnnnncaacgcttctaatcttctccatctactctcttacgtcactgtaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35955131 |
ggaagaacttccaaccttttgagtctgccgcttccgaagcaccggtagaaaaaa-caacgcttctaatcttctccatctactctcttacgtcactgtaag |
35955229 |
T |
|
| Q |
116 |
cactttcactttttctttgctctcttaattgagtatactatacccttttctttcatactaaaacctgaaaatgccacttttatccccttcagcccctctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35955230 |
cactttcactttttctttgctctcttaattgagtatactatacccttttctttcatactaaaacctgaaaatgccacttttatccccttcagcccctttg |
35955329 |
T |
|
| Q |
216 |
tg |
217 |
Q |
| |
|
|| |
|
|
| T |
35955330 |
tg |
35955331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 33903707 - 33903914
Alignment:
| Q |
16 |
ggaagaacttccaaccttttgagtctgccg----cttccgaagcaccggtagnnnnnnncaacgcttctaatcttctccatctactctcttacgtcactg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903707 |
ggaagaacttccaaccttttgagtctgccggccgcttccgaagcaccggtagaaaaaa-caacgcttctaatcttctccatctactctcttacgtcactg |
33903805 |
T |
|
| Q |
112 |
taagcactttcactttttctttgctctcttaattgagtatacta---tacccttttctttcatactaaaacctgaaaatgccacttttatccccttcagc |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33903806 |
taagcactttcactttttctttgctcttttaattgagtatactaagttacccttttctttcatactaaaacctgataatgccacttttatccccttcagc |
33903905 |
T |
|
| Q |
209 |
ccctctgtg |
217 |
Q |
| |
|
|||| |||| |
|
|
| T |
33903906 |
ccctttgtg |
33903914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University