View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18396_low_27 (Length: 212)
Name: NF18396_low_27
Description: NF18396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18396_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 4 - 164
Target Start/End: Original strand, 5906051 - 5906211
Alignment:
| Q |
4 |
gtgactcgtgaattttggacagttctcattacttatgtaaatggagctcaatgaagatcctgtactttatgaccaagataatcatgtttcttcggcagtt |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5906051 |
gtgactcttgaattttggacagttctcattacttatgtaaatggagctcaatgaagatccagtactttatgaccaagataatcatgtttcttcggcagtt |
5906150 |
T |
|
| Q |
104 |
tggatactatttaggataataagcctcaaatagtatcactatcacaaagtttaagcaatga |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5906151 |
tggatactatttaggataataagcctcaaatagtatcactatcgcaaagtttaagcaatga |
5906211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University