View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_15 (Length: 420)
Name: NF18398_high_15
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 69 - 413
Target Start/End: Complemental strand, 42286607 - 42286260
Alignment:
| Q |
69 |
ccgaagtctcatatgcttttgagaataaaattggaggagacttcatgcaccctaaacatagttcttatatagcttttttgtaaaagaaattcagagccct |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286607 |
ccgaagtctcatatgcttttgagaataaaattggaggagactgcatgcaccctaaacatagttcttatatagcttttttgtaaaagaaattcagagccct |
42286508 |
T |
 |
| Q |
169 |
aactcatgttcatgatttagggtttcattatgcttgttttttgagaaaataatacnnnnnnnnnnnnnnnnnn---ttcgagaagggtgtgtgcatgttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42286507 |
aactcatgttcatgatttagggtttcattatgcttgttttttgagaaaataatacaaaaaaaaaaaaaaaaaaaaattcgagaagggtgtgtgcatgttg |
42286408 |
T |
 |
| Q |
266 |
aagttttaagtaataatgaaaataaaaataattaagctacttgcttggtgttccaggttgattccttcttttcttttgaggaactgtggttgaaggagct |
365 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286407 |
aagctttaagtaataatgaaaataaaaataattaagctacttgcttggtgttccaggttgattccttcttttcttttgaggaactgtggttgaaggagct |
42286308 |
T |
 |
| Q |
366 |
gaggaagtagcagaagtagtagttgattgaggatgaggatgatgatgt |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286307 |
gaggaagtagcagaagtagtagttgattgaggatgaggatgatgatgt |
42286260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 303 - 350
Target Start/End: Original strand, 12805364 - 12805411
Alignment:
| Q |
303 |
tacttgcttggtgttccaggttgattccttcttttcttttgaggaact |
350 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| || ||||||||| |
|
|
| T |
12805364 |
tacttgcatggtgttccaggttgatttcttctttttttctgaggaact |
12805411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University