View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_40 (Length: 287)
Name: NF18398_high_40
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_40 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 12559502 - 12559577
Alignment:
| Q |
212 |
agggtgattgctcatcttgttgatagttacttgaaagggaaaagaagcagtaaaaacatagggagatatgtgaaaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12559502 |
agggtgattgctcatcttgttgatagttacttgaaagggaaaagaagcagtaaaaacatagggtgatatgtgaaaa |
12559577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 193 - 259
Target Start/End: Complemental strand, 44836716 - 44836650
Alignment:
| Q |
193 |
cagactcctatatcattggagggtgattgctcatcttgttgatagttacttgaaagggaaaagaagc |
259 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| || |||||| |||||||||| | |||||| |
|
|
| T |
44836716 |
cagactcctatataattggagggttattgctcatcttttttatagttgcttgaaaggggagagaagc |
44836650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University