View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_45 (Length: 258)
Name: NF18398_high_45
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 61 - 246
Target Start/End: Complemental strand, 39668783 - 39668598
Alignment:
| Q |
61 |
tgtataggcaaagactacaaaataatgcttaaaattgaattgatgattattgtaggtccccgcatcgactaaacctgctttgcattaaatccttttattt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39668783 |
tgtataggcaaagactacaaaataatgcttaaaattgaattgatgattattgtaggtccccgcatcgactaaacctgctttgcattaaatccttttattt |
39668684 |
T |
 |
| Q |
161 |
tatttaacatatcaatttcaaatggaaccnnnnnnnnctcctctacnnnnnnnggaaccttttttgccaagacccgcatattcttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39668683 |
tatttaacatatcaatttcaaatggaaccttttttttttcctttacaaaaaaaggaaccttttttgccaagacccgcatattcttc |
39668598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 39669731 - 39669697
Alignment:
| Q |
1 |
tttgtgtataatatagcactaatttacttttagtt |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39669731 |
tttgtgtataatatagcactaatttacttttagtt |
39669697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University