View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18398_high_50 (Length: 249)

Name: NF18398_high_50
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18398_high_50
NF18398_high_50
[»] chr4 (1 HSPs)
chr4 (15-241)||(46909629-46909855)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 46909629 - 46909855
Alignment:
15 aataaccatagacaggctacaccataaagccagctgcagaggatccgaatttgaggatggatagatgatggagagaaagagaggaattgagagatatatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
46909629 aataaccatagacaggctacaccataaagccagctgcagaggatccgaatttgaggatggatagatgatggagggaaagagaggaattgagagatatatg 46909728  T
115 tattggaaagtatttgggtccattcacatggagctgcnnnnnnncacatgagcgctccaattataatgccaagattttggagagaaatagaaaaaatgaa 214  Q
    |||||||||||||||| ||||||||||||||||||||        ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
46909729 tattggaaagtatttgagtccattcacatggagctgcttttttttacatgagtgctccaattataatgccaagattttggagagaaatagaaaaaatgaa 46909828  T
215 aactaaaatctcccaggtacctttgct 241  Q
    |||||||||||||||||||||||||||    
46909829 aactaaaatctcccaggtacctttgct 46909855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University