View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_52 (Length: 243)
Name: NF18398_high_52
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 51231219 - 51231065
Alignment:
| Q |
18 |
tattatggatgtccgcaaattattttccttttcctttaacaagagggcagtgcaagcaaatccatccaaaaagtaccacgcaaatctaaggcataggatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231219 |
tattatggatgtccgcaaattattttccttttcctttaacaagagggcagtgcaagcaaatccatccaaaaagtaccacgcaaatctaaggcataggatc |
51231120 |
T |
 |
| Q |
118 |
aagtgtttctttgaagtgcatctcccactttataaagcaaaaccactcacaaaaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231119 |
aagtgtttctttgaagtgcatctcccactttataaagcaaaaccactcacaaaaa |
51231065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 170 - 238
Target Start/End: Complemental strand, 51231017 - 51230949
Alignment:
| Q |
170 |
aaatctaataggccccaataccttttagtacttaccacttttcctgccaatgtttatcagtataattta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51231017 |
aaatctaataggccccaataccttttagtacttaccacttttcctgccaatgtttatcaaaataattta |
51230949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University