View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_54 (Length: 241)
Name: NF18398_high_54
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_54 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 53822316 - 53822535
Alignment:
| Q |
21 |
aggccttcgtctagccgcctgcgatgttatggcttctttggttcgcaaataaaaccttcaaacacttaccacctacaccgccttcttacacaattttcac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53822316 |
aggccttcgtctagccgcctgcgatgttatggcttctttggttcgcaaataaaaccttcaa-cacttaccacctacaccgccttcttacacaattttcgc |
53822414 |
T |
 |
| Q |
121 |
tagtttcgagaatttaggtaccccgattataatcagtcactatttcgatcactaaatttattagtgaccgatgttgatgaaatgacgatcgaatattcaa |
220 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
53822415 |
tagtttcgagaatttaggtaccccaactataatcaatcactatttcggtcactaaatttattagtgaccgattttgatgaaatgacgatggaatattcaa |
53822514 |
T |
 |
| Q |
221 |
tctttaaacgactgatttcta |
241 |
Q |
| |
|
|||||||| || ||||||||| |
|
|
| T |
53822515 |
tctttaaaagattgatttcta |
53822535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University