View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_high_56 (Length: 239)
Name: NF18398_high_56
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 23 - 94
Target Start/End: Original strand, 39475082 - 39475153
Alignment:
| Q |
23 |
ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475082 |
ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa |
39475153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University