View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_45 (Length: 261)
Name: NF18398_low_45
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 36747776 - 36747546
Alignment:
| Q |
21 |
actgacatccttgcttaatttgtgatgata-tataatcataatcatattgatcctcccttgaaccaaatcactgctctatttgatcgttcacgattttaa |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36747776 |
actgacatccttgcttagtttgtgatgataatataatcgtaatcatattgatcctcccttgaaccaaatcactgctctatttgaccgttcacgattttaa |
36747677 |
T |
 |
| Q |
120 |
ttttcacacaattcaacgtacttatcaaataaaatcacataagcacaaagtacaaagaacctaacaaaaatgtctttataaaagcccttaaaaatgtctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36747676 |
ttttcacacaattcaacgtacttatcaaataaaatcacataagcacaaagtacaaagaacctaacaaaaatgtctttataaaagcccttaaaaatgtctt |
36747577 |
T |
 |
| Q |
220 |
ataataataagataagattaaagcacttcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36747576 |
ataataataagataagattaaagcacttcat |
36747546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University