View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18398_low_46 (Length: 258)

Name: NF18398_low_46
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18398_low_46
NF18398_low_46
[»] chr3 (2 HSPs)
chr3 (61-246)||(39668598-39668783)
chr3 (1-35)||(39669697-39669731)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 61 - 246
Target Start/End: Complemental strand, 39668783 - 39668598
Alignment:
61 tgtataggcaaagactacaaaataatgcttaaaattgaattgatgattattgtaggtccccgcatcgactaaacctgctttgcattaaatccttttattt 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39668783 tgtataggcaaagactacaaaataatgcttaaaattgaattgatgattattgtaggtccccgcatcgactaaacctgctttgcattaaatccttttattt 39668684  T
161 tatttaacatatcaatttcaaatggaaccnnnnnnnnctcctctacnnnnnnnggaaccttttttgccaagacccgcatattcttc 246  Q
    |||||||||||||||||||||||||||||         |||| |||       |||||||||||||||||||||||||||||||||    
39668683 tatttaacatatcaatttcaaatggaaccttttttttttcctttacaaaaaaaggaaccttttttgccaagacccgcatattcttc 39668598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 39669731 - 39669697
Alignment:
1 tttgtgtataatatagcactaatttacttttagtt 35  Q
    |||||||||||||||||||||||||||||||||||    
39669731 tttgtgtataatatagcactaatttacttttagtt 39669697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University