View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_47 (Length: 258)
Name: NF18398_low_47
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 3652113 - 3652349
Alignment:
| Q |
6 |
agcagcagagagatacttaggttacaacaatgctattttagctcttgctccttatggagattattggcgaaacatgagaaaaatttcaactcttgagctt |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3652113 |
agcagcagggagatacttaggttacaacaatgctattttagctcttgctccttatggagattattggcgatacatgagaaaaatttcaactcttgagctt |
3652212 |
T |
 |
| Q |
106 |
ttatcaagtcataggcttgaaaagctaaagcatgttagagattttgagatatattctctagtaaaaaatttgtacacatttgtgnnnnnnncaaatggtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3652213 |
ttatcaagtcataggcttgaaaagctaaagcatgttagagattttgagatatattctctagtaaaaaatttgtacacatttgtgaaaaaaacaaatggtt |
3652312 |
T |
 |
| Q |
206 |
caattgaagtacctattagcaagtttttagatcatat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652313 |
caattgaagtacctattagcaagtttttagatcatat |
3652349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University