View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_50 (Length: 254)
Name: NF18398_low_50
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_50 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 53822807 - 53822572
Alignment:
| Q |
19 |
ggtagtcaaagtttgttaacatgtgaaaaaacaattcgctatgccgttgtgataaacctttcgctatatatatcatttcccttttgaggccatgttgtat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53822807 |
ggtagtcaaagtttgttaacatgtgaaaaaacaattcgctatgccgtcgtgataaaccttttgctatatatatcatttcccttttgaggccatgttgtat |
53822708 |
T |
|
| Q |
119 |
aagttttgttgcactccttaaatgtcggctctgtctttaatataaaaaatagtttatgtaataaaataaattagaaatgttctggttaaaagagagatat |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53822707 |
aagttttgttgcaccccttaaatgtcggctcagtctttaatataaaaaatagtttatgtaataaaataaattagaaatgttctggttaaaagagagatat |
53822608 |
T |
|
| Q |
219 |
atttctcacaagggtcatgtctaacgagcgactctt |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53822607 |
atttctcacaagggttatgtctaacgagcgactctt |
53822572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University