View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_51 (Length: 249)
Name: NF18398_low_51
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 46909629 - 46909855
Alignment:
| Q |
15 |
aataaccatagacaggctacaccataaagccagctgcagaggatccgaatttgaggatggatagatgatggagagaaagagaggaattgagagatatatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46909629 |
aataaccatagacaggctacaccataaagccagctgcagaggatccgaatttgaggatggatagatgatggagggaaagagaggaattgagagatatatg |
46909728 |
T |
 |
| Q |
115 |
tattggaaagtatttgggtccattcacatggagctgcnnnnnnncacatgagcgctccaattataatgccaagattttggagagaaatagaaaaaatgaa |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46909729 |
tattggaaagtatttgagtccattcacatggagctgcttttttttacatgagtgctccaattataatgccaagattttggagagaaatagaaaaaatgaa |
46909828 |
T |
 |
| Q |
215 |
aactaaaatctcccaggtacctttgct |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46909829 |
aactaaaatctcccaggtacctttgct |
46909855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University