View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_54 (Length: 242)
Name: NF18398_low_54
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 47582216 - 47582434
Alignment:
| Q |
9 |
cacagaaaaccaaaaagtatatggcggtgcttggtgcctcccgtgcctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582216 |
cacagaaaaccaaaaagtatatggcggtgcttggtgcctcccatgcctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttcca |
47582315 |
T |
 |
| Q |
109 |
accagttgctgcagaggaaaatctggaggcacaatattatatcccagttgtggtgttagatttgaattatatccattccacaaggcagacgacaataatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582316 |
accagttgctgcagaggaaaatctggaggcacaatattatatcccagttgtggtgttagatttgaattatatccattccacaaggcagacgacaataatt |
47582415 |
T |
 |
| Q |
209 |
cttgggtgctgcccccacc |
227 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
47582416 |
cttgggtgctgcctccacc |
47582434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 47572518 - 47572713
Alignment:
| Q |
9 |
cacagaaaaccaaaaagtatatggcggtgcttggtgcctcccgtgcctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttcca |
108 |
Q |
| |
|
|||||| ||||||||| ||||||| || ||||||| |||| | ||||||| |||| ||||| |||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
47572518 |
cacagacaaccaaaaactatatggttatgtttggtgcgtcccatacctatcttcagaaaactgtagctggtgtcttagcgatgccatagcagaaattcca |
47572617 |
T |
 |
| Q |
109 |
accagttgctgcagaggaaaatctggaggcacaatattatatcccagttgtggtgttagatttgaattatatccattccacaaggcagacgacaat |
204 |
Q |
| |
|
|| ||||| |||||||||||||||||||| ||||||| ||||||||||||||| ||| |||||| ||| |||| |||||||||||| || ||||| |
|
|
| T |
47572618 |
actagttgttgcagaggaaaatctggaggagcaatattttatcccagttgtggtcttaaatttgacttaaatcctttccacaaggcacacaacaat |
47572713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University