View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18398_low_68 (Length: 207)
Name: NF18398_low_68
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18398_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 23139907 - 23139735
Alignment:
| Q |
14 |
agtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaactagaagatactgttagtagacctcctatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23139907 |
agtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatgtgagcttaactagaagatactgttagtagacctcctatt |
23139808 |
T |
 |
| Q |
114 |
gataatgtgtatgttaaacgcatgcccgagttaatgtaattgtgtgtttaaatcgaataaggatggcataaca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23139807 |
gataatgtgtatgttaaacgcatgcccgagttcatgtaattgtgtgtttaaatcgaataaggatggcataaca |
23139735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 96
Target Start/End: Complemental strand, 23148618 - 23148537
Alignment:
| Q |
15 |
gtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaactagaagatactg |
96 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| ||||||||||| || | |||||||| ||||||||| |||| |
|
|
| T |
23148618 |
gtgaggagaaaagatgatcttttattgtgcccttttgtttatcatcctttgcaagttacatgagcttcactagaagaaactg |
23148537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 23038900 - 23038836
Alignment:
| Q |
16 |
tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagct |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
23038900 |
tgagaagaaaagatgatcttttattgttttcttttgtttatcatcctttgtaagtcatatgagct |
23038836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 23145780 - 23145729
Alignment:
| Q |
15 |
gtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
23145780 |
gtgagaagaaaagatgatcttttattgtgcccttttgtttataatcctttgc |
23145729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 23016921 - 23016856
Alignment:
| Q |
16 |
tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt |
81 |
Q |
| |
|
|||| ||||||||||| |||||| | ||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
23016921 |
tgaggagaaaagatgaccttttactattgccttttgtttatcatcctttgaatgtcagatgagctt |
23016856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 23036029 - 23035964
Alignment:
| Q |
16 |
tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt |
81 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||| ||||| ||||||| ||| |||||||||||||| |
|
|
| T |
23036029 |
tgagaagaaaggatgaacttttattgttttcttctgtttatcatcctctgcatgtcatatgagctt |
23035964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 23024126 - 23024077
Alignment:
| Q |
21 |
agaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgt |
70 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
23024126 |
agaaaagatgatctattattgttaccttctgtttatcatcatttgcctgt |
23024077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University