View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18398_low_68 (Length: 207)

Name: NF18398_low_68
Description: NF18398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18398_low_68
NF18398_low_68
[»] chr3 (7 HSPs)
chr3 (14-186)||(23139735-23139907)
chr3 (15-96)||(23148537-23148618)
chr3 (16-80)||(23038836-23038900)
chr3 (15-66)||(23145729-23145780)
chr3 (16-81)||(23016856-23016921)
chr3 (16-81)||(23035964-23036029)
chr3 (21-70)||(23024077-23024126)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 23139907 - 23139735
Alignment:
14 agtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaactagaagatactgttagtagacctcctatt 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
23139907 agtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatgtgagcttaactagaagatactgttagtagacctcctatt 23139808  T
114 gataatgtgtatgttaaacgcatgcccgagttaatgtaattgtgtgtttaaatcgaataaggatggcataaca 186  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
23139807 gataatgtgtatgttaaacgcatgcccgagttcatgtaattgtgtgtttaaatcgaataaggatggcataaca 23139735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 96
Target Start/End: Complemental strand, 23148618 - 23148537
Alignment:
15 gtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaactagaagatactg 96  Q
    ||||| ||||||||||||||||||||||  |||||||||| |||||||||||  || | |||||||| ||||||||| ||||    
23148618 gtgaggagaaaagatgatcttttattgtgcccttttgtttatcatcctttgcaagttacatgagcttcactagaagaaactg 23148537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 23038900 - 23038836
Alignment:
16 tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagct 80  Q
    ||||||||||||||||||||||||||||  ||||||||| ||||||||||   ||||||||||||    
23038900 tgagaagaaaagatgatcttttattgttttcttttgtttatcatcctttgtaagtcatatgagct 23038836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 23145780 - 23145729
Alignment:
15 gtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgc 66  Q
    ||||||||||||||||||||||||||||  |||||||||| | |||||||||    
23145780 gtgagaagaaaagatgatcttttattgtgcccttttgtttataatcctttgc 23145729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 23016921 - 23016856
Alignment:
16 tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt 81  Q
    |||| ||||||||||| |||||| | ||||||||||||| ||||||||||  ||||| ||||||||    
23016921 tgaggagaaaagatgaccttttactattgccttttgtttatcatcctttgaatgtcagatgagctt 23016856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 23036029 - 23035964
Alignment:
16 tgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt 81  Q
    |||||||||| ||||| |||||||||||  ||| ||||| ||||||| ||| ||||||||||||||    
23036029 tgagaagaaaggatgaacttttattgttttcttctgtttatcatcctctgcatgtcatatgagctt 23035964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 23024126 - 23024077
Alignment:
21 agaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgt 70  Q
    |||||||||||||| |||||||| |||| ||||| ||||| |||||||||    
23024126 agaaaagatgatctattattgttaccttctgtttatcatcatttgcctgt 23024077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University