View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18399_high_6 (Length: 278)

Name: NF18399_high_6
Description: NF18399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18399_high_6
NF18399_high_6
[»] chr2 (2 HSPs)
chr2 (21-131)||(37718779-37718889)
chr2 (213-262)||(28617351-28617400)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 21 - 131
Target Start/End: Original strand, 37718779 - 37718889
Alignment:
21 ataaattcataatgggacgaaataaaagaaagatataaataaaatgatgagttaaataagtgtaggaaaaggtgggatgtttaaatattatggttgatta 120  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||    
37718779 ataaatttataatgggacgaaataaaagaaagatataaataaaatgatgagttaaataagtgtaggaaaaagtgggatgttcaaatattatggttgatta 37718878  T
121 taaaataacgt 131  Q
    |||||||||||    
37718879 taaaataacgt 37718889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 28617351 - 28617400
Alignment:
213 tccatgagagatatcatttacttccatttttaaatccttaaccatacact 262  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||    
28617351 tccatgagagatatcatttacttccacttttaaatccttaaccatacact 28617400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University