View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18399_high_7 (Length: 263)
Name: NF18399_high_7
Description: NF18399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18399_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 2094713 - 2094485
Alignment:
| Q |
13 |
acctgtgttggaccatccaactattagagatgatctatatccattttttgacccataatttcattcatacaaagacaaaaatgatacactgcatcatagc |
112 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
2094713 |
acctatgttggaccatccagctattagagaggatctatatccattttttgacccataatttcattcatacaaagacaaaaatgatacaccgcgtcatagc |
2094614 |
T |
 |
| Q |
113 |
atgatcatgtgatctcacaaaatgggatgcgcnnnnnnnnnagattaacaatgtgctttcatccttttaatttgttgttgagttcatgcatgtgactagt |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2094613 |
atgattttgtgatctcacaaaatgggatgcg-attttttttagattaacaatgtgctttcatccttttaatttgttgttgagttcatgcatgtgactagt |
2094515 |
T |
 |
| Q |
213 |
tcgtttgattaacatatgtagtgtataatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2094514 |
tcgtttgattaacatatgtagtgtataatg |
2094485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University