View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1839_low_6 (Length: 380)
Name: NF1839_low_6
Description: NF1839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1839_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 44 - 184
Target Start/End: Complemental strand, 51909156 - 51909016
Alignment:
| Q |
44 |
attgttgtactcgtgcaaaggaaatgggtggaaactagaaaagtaactgtaaagaagaatgataaagagaggggtagaaagacagtcattattgctactg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51909156 |
attgttgtactcgtgcaaaggaaatgggtggaaactagaaaagtaactgtaaagaagaatgataaagagaggggtagaaagacagtcattattgctactg |
51909057 |
T |
|
| Q |
144 |
gattctgactgtccacaccaccaccattttaaaaattgtca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51909056 |
gattctgactgtccacaccaccaccattttaaaaattgtca |
51909016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 256 - 363
Target Start/End: Complemental strand, 51908944 - 51908836
Alignment:
| Q |
256 |
ctatattcctttttaagtattttagaagatgaatacannnnnnnnn-gttgccaaatagtgtgttttatcatcgttttaaagaactgtaaataaggggaa |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51908944 |
ctatattcctttttaagtattttagaagatgaatacatttttttgttgttgccaactagtgtgttttatcatcgttttaaagaactgtaaataaggggaa |
51908845 |
T |
|
| Q |
355 |
actgtgaac |
363 |
Q |
| |
|
||||||||| |
|
|
| T |
51908844 |
actgtgaac |
51908836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University