View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1839_low_8 (Length: 271)
Name: NF1839_low_8
Description: NF1839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1839_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 3359320 - 3359088
Alignment:
| Q |
11 |
ttatactgacaattaaaaggtctccacattactgcactcgatgaactttttaaaatatacaacgatcttatcttccaagcaattcaccc--tatacatat |
108 |
Q |
| |
|
||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3359320 |
ttataatgacaattagaaggtctccacattgctgcactcgatgaactttttaaaatatacaacgatcttatcttccaagcaattcaccctatatacatat |
3359221 |
T |
 |
| Q |
109 |
aaaaaatcaacggactaaaattaaacatccaagccatatgttatttgaccaaaagaaaacctcataaatttgttggactcctcataaatgatgatacacc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359220 |
aaaaaatcaacggactaaaattaaacatccaagccatatgt---------------aaacctcataaatttgttggactcctcataaatgatgatacact |
3359136 |
T |
 |
| Q |
209 |
gagccaaagaagttacattagtggcaaccgaaagttgatttagttttt |
256 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
3359135 |
gagccaaagaagttacattagtggcgaacgaaagttgatttaattttt |
3359088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University