View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18400_high_26 (Length: 242)
Name: NF18400_high_26
Description: NF18400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18400_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 47846032 - 47846241
Alignment:
| Q |
13 |
atgaattccaacccacttaacttttgtggataataattattattactactagatgttgttgtttcagtgaaacttccttgtccttgtaccaattctggtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47846032 |
atgaattccaacccacttaacttttgtggataataattattattactactagatgttgttgtttcagtgaaacttccttgtccttgtaccaattcttgtc |
47846131 |
T |
|
| Q |
113 |
ctgctactccctcaacacaatattggttagtttgagtttgtgagaaatattgcaagatttggttgttgttaatagagttgatgcaacctgcagaaatata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47846132 |
ctgctactccctcaacacaatattggttagtttgagtttgtgagaaatattgcaagatttggttgttgttaatagagttgatgcaac---cagaaatata |
47846228 |
T |
|
| Q |
213 |
atttgcttgttgt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47846229 |
atttgcttgttgt |
47846241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University