View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18400_high_7 (Length: 435)
Name: NF18400_high_7
Description: NF18400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18400_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 162 - 392
Target Start/End: Complemental strand, 45142362 - 45142132
Alignment:
| Q |
162 |
ccctcgcctccttctaaggtgctcataagatctgtttattggatctaattaattatgctaacaaccaaagtaatattatggtatgtgttttagtctcaag |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142362 |
ccctcgcctccttctaaggtgctcataagatctgtttattggatctaattaattatgctaacaaccaaagtaatattatggtatgtgttttagtctcaag |
45142263 |
T |
 |
| Q |
262 |
aaagtaagaaaaaggtaaagggaagtctttgagtaaaattggtatcatgttacaggagtatcgagtatttggaccatttcttcagctgctggcttcaata |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142262 |
aaagtaagaaaaaggtaaagggaagtctttgagtaaaattggtatcatgttacaggagtatcgagtatttggaccatttcttcagctgctggcttcaata |
45142163 |
T |
 |
| Q |
362 |
gcttcataaaagttaatcattaatattattt |
392 |
Q |
| |
|
|| ||| |||||||||||||||||||||||| |
|
|
| T |
45142162 |
gcgtcaaaaaagttaatcattaatattattt |
45142132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 42 - 116
Target Start/End: Complemental strand, 45142632 - 45142558
Alignment:
| Q |
42 |
gattgacaacaaaggaagaaaatgttgaagaatcgaaaaaatagcctaaacaagaggatgcagcacgaaagtgtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142632 |
gattgacaacaaaggaagaaaatgttgaagaattgaaaaaatagcctaaacaagaggatgcagcacgaaagtgtt |
45142558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University