View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18400_low_15 (Length: 320)
Name: NF18400_low_15
Description: NF18400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18400_low_15 |
 |  |
|
| [»] scaffold0076 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0076 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 58933 - 58647
Alignment:
| Q |
18 |
gattggacaggtgcaacaaaacagaagataaaagagcttaaacaatcatttaacaggtagttgttgatagctcaatgcctatgtattctttcccgctttc |
117 |
Q |
| |
|
||||| |||| || |||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
58933 |
gattgaacagatggaacaaagtagaagataaaagagcttaaacaatcattgaacaggtagctgttgatagctcaatgcctatgtattctttctcgctttc |
58834 |
T |
 |
| Q |
118 |
gatttcacttatctttcttttaagttgggtgtctgaaagattgagttttaattacttgttttacattaatagatttataaggttgcattcttaaatgcct |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58833 |
gatgtcacttatctttcttttaagttgggtgtctgaaagattgagttttaattacttgttttacattaatagatttataaggttgcattcttaaatgcct |
58734 |
T |
 |
| Q |
218 |
catatgtgatgttctataattttaaacgccacaaatgtgatgttctattattttttaggtacacttttgattcttcaaatgtgctct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58733 |
catatgtgatgttctataattttaaacgccacaaatgtgatgttctagttttttttaggtacacttttgattcttcaaatgtgctct |
58647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 304
Target Start/End: Complemental strand, 58642 - 58614
Alignment:
| Q |
276 |
gtacacttttgattcttcaaatgtgctct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
58642 |
gtacacttttgattcttcaaatgtgctct |
58614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 150 - 240
Target Start/End: Complemental strand, 29749637 - 29749547
Alignment:
| Q |
150 |
ctgaaagattgagttttaattacttgttttacattaatagatttataaggttgcattcttaaatgcctcatatgtgatgttctataatttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||| | |||||||||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
29749637 |
ctgaaagattgagttttaattacttgttgtacagtaatggttttataaggttgcattcttaaaagcctcatttgtgatggtctataatttt |
29749547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 29749708 - 29749637
Alignment:
| Q |
39 |
cagaagataaaagagcttaaacaatcatttaacaggtagttgttgatagctcaatgcctatgtattctttcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
29749708 |
cagaagataaaagagcttaaacaatcattgaacaggtagctgttgatagctcaatgtctatgtattctttcc |
29749637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 253 - 304
Target Start/End: Complemental strand, 29749565 - 29749514
Alignment:
| Q |
253 |
tgtgatgttctattattttttaggtacacttttgattcttcaaatgtgctct |
304 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29749565 |
tgtgatggtctataatttttttggtacacttttgattcttcaaatgtgctct |
29749514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University