View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18400_low_32 (Length: 201)
Name: NF18400_low_32
Description: NF18400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18400_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 34666714 - 34666533
Alignment:
| Q |
1 |
atttttatcaaattacagcattaggtgtatgcctacaaatatactagtattaaccaggaaattactaatactattagtaaccaa---ttaannnnnnnnn |
97 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||| || || |
|
|
| T |
34666714 |
atttttatcaaattacaacattaggtatatgcctacaaatatactagtattaaccaagaaattactaatattattagtaacaaatttttttttttttttt |
34666615 |
T |
 |
| Q |
98 |
actgaacataactactaattgcttaaagaacaatgaaagaatttaatatannnnnnnggtgcaatgaaaaggtataattaaa |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34666614 |
actgaacataactactaactgcttaaagaacaatcaaagaatttaatataaatttttggtacaatgaaaaggtataattaaa |
34666533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University